Mormyrops masuianus
Distribution:
Malebo Pool and Western & Middle Congo basin, (type locality Lisala). See Fishbase for localities and museum records.
Mormyrops masuianus Boulenger, 1898
EOL Text
General Description:
From Boulenger 1909, pp. 38–39.
Depth of body 6 times in total length, length of head 4 2/3 times. Head 1 2/3 as long as deep, with straight, declivous upper profile; snout rounded, projecting a little beyond the mouth; width of mouth a little greater than length of snout; teeth truncate, 12 in upper jaw, 14 in lower; eye very small, situated in anterior third of head, its diameter 3 times in length of snout or interorbital width. Dorsal 30-31, 4/5 length of anal, originating 1 2/3 as far from end of snout as from base of caudal. Anal 40–46, originating a little in advance of dorsal (its 7th or 8th ray corresponding to first dorsal), and slightly nearer head than base of caudal. Pectoral ½ length of head. Caudal rather small, densely scaled, with rounded lobes. Caudal peduncle 2 ½ times as long as deep, ½ length of head. 90-93 scales in lateral line, 14-15/19-20 in transverse series on body. 21-23 in transverse series between dorsal and anal, 18 round caudal peduncle. Pale brownish.
Total length 410 millim.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Sullivan, John P., G.A. Boulenger, Africhthy |
| Source | http://mormyrids.lifedesks.org/pages/2164 |
Range Description:
Mormyrops masuianus is known from the Lower Congo, Pool Malebo (Stanley Pool) and from the Central Congo River basin.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | International Union for Conservation of Nature and Natural Resources |
| Source | http://www.iucnredlist.org/apps/redlist/details/182626 |
Africa: lower and middle Congo River basin in Central African Republic (Ref. 42005), Republic of Congo (Ref. 53209) and Democratic Republic of the Congo (Ref. 41590, 42476).
| License | http://creativecommons.org/licenses/by-nc/3.0/ |
| Rights holder/Author | Pascualita Sa-a, FishBase |
| Source | http://www.fishbase.org/summary/SpeciesSummary.php?id=10946 |
Distribution:
Malebo Pool and Western & Middle Congo basin, (type locality Lisala). See Fishbase for localities and museum records.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Sullivan, John P., Sullivan, John P., Africhthy |
| Source | http://mormyrids.lifedesks.org/pages/2164 |
Central Africa.
Max. size:
41.0 cm TL (male/unsexed; (Ref. 42476))
| License | http://creativecommons.org/licenses/by-nc/3.0/ |
| Rights holder/Author | Pascualita Sa-a, FishBase |
| Source | http://www.fishbase.org/summary/SpeciesSummary.php?id=10946 |
Habitat and Ecology:
Habitat and Ecology
This is a demersal species.
Systems
- Freshwater
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | International Union for Conservation of Nature and Natural Resources |
| Source | http://www.iucnredlist.org/apps/redlist/details/182626 |
Environment:
demersal; freshwater
| License | http://creativecommons.org/licenses/by-nc/3.0/ |
| Rights holder/Author | Pascualita Sa-a, FishBase |
| Source | http://www.fishbase.org/summary/SpeciesSummary.php?id=10946 |
Barcode data: Mormyrops masuianus:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTATACCTAGTATTTGGGGCTTGAGCCGGAATAGTGGGCACTGCACTGAGCCTCCTTATCCGAGCGGAATTAAACCAACCAGGGGCGCTGCTTGGCGACGACCAGATTTATAATGTTATCGTCACAGCACACGCCTTCGTAATAATTTTCTTCATAGTAATGCCAATCATGATCGGCGGCTTTGGCAACTGATTAATCCCCCTTATGATCGGCGCCCCAGATATAGCATTCCCCCGAATGAACAACATAAGCTTCTGACTCCTACCACCATCTTTTCTCCTTCTACTTGCCTCCTCTGGAGTCGAAGCTGGAGTTGGAACAGGATGAACTGTCTATCCCCCCCTGGCTGGCAATTTGGCCCACGCCGGAGCCTCTGTAGACCTAGCTATTTTCTCTCTCCACTTAGCCGGTGTTTCTTCCATCCTTGGCTCTATCAACTTCATTACCACAATCATCAACATAAAACCCCCAGCAATCTCCCAATACCAAACCCCCCTCTTTATTTGAGCCCTATTAGTGACCACCGTCCTACTACTACTATCCCTGCCAGTCCTAGCTGCAGGAATCACAATACTGCTAACGGATCGAAACCTAAACACAACATTCTTCGACCCGGCAGGCGGAGGAGACCCAATCCTCTACCAACACCTA
-- end --
-- end --
Statistics of barcoding coverage: Mormyrops masuianus:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1