Mormyrops lineolatus Boulenger, 1898
Behaviour:
EOD unknown.
Distribution:
Congo basin. Collected in Odzala National Park, Lékoli River, Congo. See Fishbase for museum records.
Mormyrops lineolatus Boulenger 1898
EOL Text
General Description:
From Boulenger 1909, pp. 42-43
Depth of body 5 to 6 times in total length, length of head 3 2/3 to 5 times. Head 1 2/3 to 1 3/4 times as long as deep, upper profile slightly concave; snout rounded; jaws equal; width of mouth nearly equal to length of snout; teeth truncate, 16 to 22 in each jaw; eye small, in anterior third of head, its diameter 2 to 3 times in length of snout or in interocular width. Dorsal 29-32, 3/5 to 2/3 length of anal, originating 1 2/3 to 2 1/4 times as far from end of snout as from base of caudal. Anal 46-50, originating considerably in advance of dorsal (11th to 15th ray corresponding to first dorsal), and a little nearer head than root of caudal. Pectoral rounded, 1/2 length of head. Caudal small, densely scaled, with rounded lobes. Caudal peduncle as long as deep, 1/4 to 1/5 length of head. 80-90 scales in lateral line, 14-16/16-21 in transverse series on body, 23-25 in transverse series between dosal and anal, 16-18 round caudal peduncle. Pale brown, with dark lines along the series of scales.
Total length 400 mm.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Sullivan, John P., G.A. Boulenger, Africhthy |
| Source | http://mormyrids.lifedesks.org/pages/2162 |
Range Description:
Mormyrops lineolatus is known from Pool Malebo (Stanley Pool) and from the Central Congo River basin. It is not known from the Ubangui, Kwango and Kasai systems.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | International Union for Conservation of Nature and Natural Resources |
| Source | http://www.iucnredlist.org/apps/redlist/details/182067 |
Africa: middle Congo River basin, in Pool Malebo (Ref. 41585), middle Congo River (Ref. 42476), Lake Mai-Ndombe (Ref. 1878) and Wagenia Falls (Ref. 42480), in Democratic Republic of the Congo.
| License | http://creativecommons.org/licenses/by-nc/3.0/ |
| Rights holder/Author | Pascualita Sa-a, FishBase |
| Source | http://www.fishbase.org/summary/SpeciesSummary.php?id=10944 |
Distribution:
Congo basin. Collected in Odzala National Park, Lékoli River, Congo. See Fishbase for museum records.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Sullivan, John P., Sullivan, John P., Africhthy |
| Source | http://mormyrids.lifedesks.org/pages/2162 |
Central Africa.
Max. size:
40.0 cm TL (male/unsexed; (Ref. 42476))
| License | http://creativecommons.org/licenses/by-nc/3.0/ |
| Rights holder/Author | Pascualita Sa-a, FishBase |
| Source | http://www.fishbase.org/summary/SpeciesSummary.php?id=10944 |
Habitat and Ecology:
Habitat and Ecology
This is a demersal species.
Systems
- Freshwater
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | International Union for Conservation of Nature and Natural Resources |
| Source | http://www.iucnredlist.org/apps/redlist/details/182067 |
Environment:
demersal; freshwater
| License | http://creativecommons.org/licenses/by-nc/3.0/ |
| Rights holder/Author | Pascualita Sa-a, FishBase |
| Source | http://www.fishbase.org/summary/SpeciesSummary.php?id=10944 |
Electric Organ Discharge:
EOD unknown.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Sullivan, John P., Sullivan, John P., Africhthy |
| Source | http://mormyrids.lifedesks.org/pages/2162 |
Barcode data: Mormyrops lineolatus:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GAGCCGGAATGGTGGGCACTGCACTGAGCCTCCTTATCCGAGCGGAATTAAACCAACCAGGGGCGCTGCTTGGCGACGATCAGATTTATAATGTCATCGTCACAGCACACGCCTTCGTAATAATTTTCTTCATGGTAATGCCAATCATGATCGGCGGCTTTGGCAACTGACTAATCCCCCTTATGCTCGGCGCCCCAGACATAGCATTCCCCCGAATGAACAACATAAGCTTCTGACTCCTACCACCATCTTTCCTCCTTCTACTTGCCTCCTCTGGAGTCGAAGCTGGGGTTGGAACAGGATGAACTGTCTACCCGCCCCTGGCCGGCAACTTAGCCCATGCCGGGGCCTCTGTAGACCTGGCCATTTTCTCCCTCCACTTAGCCGGTGTTTCCTCCATTCTTGGCTCTATCAACTTCATTACCACAATCATCAACATAAAACCCCCAGCAATCTCCCAATACCAAACCCCCCTCTTTATTTGAGCCCTGCTAGTGACCACCGTCTTACTACTACTATCCCTGCCAGTTCTAGCTGCAGGAATCACGATACTACTAACAGATCGAAACCTAAACACAACATTCTTCGACCCGGCAGGTGGAGGAGACCCAATCCTCTACCAACACCTA
-- end --
-- end --