Mormyrus tapirus
Size:
to 430 mm SL
Mormyrus tapirus Pappenheim, 1905
EOL Text
Size:
to 430 mm SL
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Sullivan, John P., Sullivan, John P., Africhthy |
| Source | http://mormyrids.lifedesks.org/pages/2205 |
Dorsal fin 2.4-3.4x length of anal; dorsal origin well before pectorals; 10-15 scales on caudal peduncle; body height 4.1-6.1x SL; caudal peduncle 2.5-4.1x long than high.
| License | http://creativecommons.org/licenses/by-nc/3.0/ |
| Rights holder/Author | Maria Lourdes D. Palomares, FishBase |
| Source | http://www.fishbase.org/summary/SpeciesSummary.php?id=5073 |
Habitat and Ecology:
Habitat and Ecology
Mormyrus tapirus is a demersal species with a weak electrical discharge. It is non-migratory.
Systems
- Freshwater
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | International Union for Conservation of Nature and Natural Resources |
| Source | http://www.iucnredlist.org/apps/redlist/details/181605 |
Environment:
demersal; freshwater
| License | http://creativecommons.org/licenses/by-nc/3.0/ |
| Rights holder/Author | Tess Cruz, FishBase |
| Source | http://www.fishbase.org/summary/SpeciesSummary.php?id=5073 |
Electric Organ Discharge:
EOD is biphasic and slightly longer than one msec in duration. Like other Mormyrus species this EOD has a small head-positive phase followed by a head-negative phase. The electric organ is composed of electrocytes with type NPp morphology (non-penetrating stalks with posterior innervation).
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Sullivan, John P., Sullivan, John P., Hopkins, Carl D., Africhthy |
| Source | http://mormyrids.lifedesks.org/pages/2205 |
Barcode data: Mormyrus tapirus:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 12 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CTATACCTAGTATTCGGGGCTTGAGCCGGAATAGTGGGCACTGCACTGAGCCTCCTAATTCGAGCCGAACTAAACCAACCTGGAGCGCTGCTTGGTGACGACCAGATTTATAATGTCATCGTCACAGCACACGCCTTCGTAATAATTTTCTTCATGGTAATACCAATCATAATTGGCGGATTTGGCAACTGGCTAATTCCTCTCATGCTAGGCGCCCCCGACATAGCCTTCCCCCGAATAAACAACATAAGCTTCTGACTCCTGCCCCCGTCATTCCTACTCCTGCTTGCCTCCTCTGGCGTGGAAGCCGGGGCCGGAACCGGATGGACTGTCTACCCCCCACTGGCCGGTAATCTAGCCCATGCAGGGGCCTCCGTAGACCTAGCCATTTTCTCCCTCCACCTGGCCGGAGTATCGTCTATTCTAGGCTCAATCAACTTCATCACCACAATTATCAACATGAAGCCGCCAGCAATCTCCCAATACCAGACCCCCCTCTTCATCTGGGCTACTCTAGTGACCACAGTTCTGCTGCTACTATCGCTGCCAGTCCTTGCCGCAGGGATCACAATGCTATTAACTGACCGAAACCTGAACACAACATTCTTTGACCCAGCAGGAGGGGGAGACCCAATTCTCTACCAACACCTA
-- end --
-- end --
Statistics of barcoding coverage: Mormyrus tapirus:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 12
Species With Barcodes: 1
Biology:
Affinities: Mormyrus rume and Mormyrus subundulatus, Mormyrus tapirus with longer snout, longer anal fin and 10-15 scales on caudal peduncle.
| License | http://creativecommons.org/licenses/by-nc/3.0/ |
| Rights holder/Author | Tess Cruz, FishBase |
| Source | http://www.fishbase.org/summary/SpeciesSummary.php?id=5073 |
IUCN Red List Assessment:
Red List Category
LC
Least Concern
Red List Criteria
3.1
Year Assessed
2010
Assessor/s
Laly, P., Moelants, T. & Olaosebikan, B.D.
Reviewer/s
Snoeks, J., Tweddle, D., Getahun, A., Laly, P., Paugy, D., Zaiss, R., Fishar, M.R.A & Brooks, E.
Contributor/s
This species has a wide distribution, with no known major widespread threats. It is therefore listed as Least Concern. It has also been assessed regionally as Least Concern for central and western Africa.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | International Union for Conservation of Nature and Natural Resources |
| Source | http://www.iucnredlist.org/apps/redlist/details/181605 |
General Description:
A large Mormyrus with slender caudal peduncle and an elongated tubular snout, 12 circumpeduncular scales, 83-97 lateral line scales and 62-74 dorsal rays. Body depth is 18.1-20.4% SL. The greatest depth at the anterior end of the dorsal fin. Head is long, 27-30% SL, upper profile of head curved downward, a concave dip anterior to eye. Snout is narrow, elongate and tubular, 47-55% HL. Mouth terminal with thick lips and fleshy somewhat bulbous chin. Teeth small and notched, five in upper jaw, six in lower, clustered near the front of the jaw. Dorsal fin origin in advance of pelvics. Eye large, about 22-29% of the length of the snout, about 11% HL; 60-70% of interorbital width. The pectoral fin is long and rounded. The caudal peduncle is long, 20.6-21% SL, 4.3-6.3 times as long as deep with 12 circumpeduncular scales. Lateral line with 83-97 scales. The nostrils are close to each other and about 1.2 eye diameter from the eye. Maximum size: 430 mm SL.
Coloration: mostly uniform brown above, silvery yellow to white below.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Sullivan, John P., Sullivan, John P., Hopkins, Carl D., Africhthy |
| Source | http://mormyrids.lifedesks.org/pages/2205 |