Marcusenius moorii
Size:
Maximum size: 214 mm SL.
Marcusenius moorii (Günther, 1867)
EOL Text
Size:
Maximum size: 214 mm SL.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Sullivan, John P., Sullivan, John P., Africhthy |
| Source | http://mormyrids.lifedesks.org/pages/2124 |
Diagnostic Description:
From Boden et al. (1997)
Diagnosis. Dorsal-fin origin situated behind anal-fin origin. Dorsal fin ends before anal fin. Dorsal fin pointed and clearly concave. Its height shorter than its length. Dorsal-fin rays are 17-26 and 24-33 anal-fin rays. Lateral-line scales 37-45. If the dark transversal band between dorsal and anal fin is visible, it is covered by only two lateral-line scales. Scales between dorsal-fin origin and anal-fin origin are 14-20.
Description. Teeth bicuspid, 5 in upper jaw, 6 in lower jaw. Submental swelling rounded, not reaching the eye margin. Snout rounded and slightly blunt. Anterior nostril in the middle between anterior tip of snout and eye, or a little closer to the eye. Posterior nostril 0·25 the distance from the eye. Eye diameter 36-74% of snout length. Preanal distance generally shorter than predorsal distance. Anal-fin base longer than dorsal. Dorsal-fin height about the same as its base. Anal-fin height shorter than its length. Pectoral fin twice as long as pelvic fin and reaching a little further than pelvic-fin base. Pelvic-fin base 0·33 closer to pectoral-fin base than to anal-fin origin. Posterior end of pelvic fin at 0·33-0·5 the distance between pelvic-fin base and anal-fin origin. Low number of dorsal-fin rays (17-26). Large variability in anal-fin rays (24-33). Lateral-line scales 37-45. Fourteen to 20 scales between dorsal- and anal-fin origins. Dark band between dorsal- and anal-fin origins, when present, extending over two lateral-line scales. Head, transversal band and a spot on the caudal-fin base dark coloured compared to rest of the body. Sometimes a second dark transversal band between the posterior ends of dorsal and anal fins. Body elongated. The electric organ has electrocytes with non penetrating stalks innervated on the posterior surface (NPp).
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Sullivan, John P., Hopkins, C.D., Boden, G., Teugels, G.G., Africhthy |
| Source | http://mormyrids.lifedesks.org/pages/2124 |
Habitat and Ecology:
Habitat and Ecology
This is a demersal species. In addition to its widespread distribution, this species is also found in the greatest number of habitats: from rivers to streams, from rapids to still water, both deep and shallow.
Systems
- Freshwater
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | © International Union for Conservation of Nature and Natural Resources |
| Source | http://www.iucnredlist.org/apps/redlist/details/181586 |
Environment:
demersal; freshwater
| License | http://creativecommons.org/licenses/by-nc/3.0/ |
| Rights holder/Author | Pascualita Sa-a, FishBase |
| Source | http://www.fishbase.org/summary/SpeciesSummary.php?id=10908 |
Electric Organ Discharge:
EOD of Marcusenius moorii has a biphasic waveform, initially head-positive, then head-negative, with a duration of about 0.39 msec for females and juveniles and as much as 0.75 msec for males. There is no initial head-negative pre-pulse for this EOD. The discharge is produced in an electric organ with non-penetrating stalked electrocytes which are innervated on the posterior surface (Type NPp; see Sullivan et al., 2000).
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Sullivan, John P., Sullivan, John P., Hopkins, Carl D., Africhthy |
| Source | http://mormyrids.lifedesks.org/pages/2124 |
Barcode data: Marcusenius moorii:
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTATACCTAGTATTCGGAGCCTGAGCCGGAATAGTGGGCACTGCACTGAGCCTACTCATCCGAGCTGAACTAAACCAACCTGGAGCCCTACTCGGGGATGACCAGATTTATAATGTTATCGTCACAGCACACGCCTTCGTAATAATTTTCTTCATGGTAATGCCCATTATGATCGGCGGCTTCGGCAACTGATTAATTCCCCTTATGCTGGGCGCCCCTGACATAGCATTCCCCCGAATAAATAACATAAGCTTCTGACTCCTGCCTCCATCATTCCTTCTTCTGCTGGCCTCTTCTGGCGTAGAGGCTGGGGCGGGTACGGGGTGAACCGTCTATCCACCGCTAGCCGGCAACCTTGCCCATGCTGGAGCCTCCGTAGACCTAGCCATTTTCTCCCTACATCTAGCCGGGGTCTCCTCCATCCTTGGTTCAATCAACTTTATTACCACAATTGTCAACATAAAACCCCCAGCAATTTCCCAATACCAAACCCCATTATTCATTTGAGCCCTACTAGTAACTACTGTGCTTCTGCTGCTATCCCTGCCAGTTTTGGCTGCAGGAATTACGATGCTACTAACGGATCGAAACCTAAACACAACATTCTTTGACCCGGCAGGCGGAGGAGATCCAATCCTCTACCAACACTTA
-- end --
-- end --
Statistics of barcoding coverage: Marcusenius moorii:
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
IUCN Red List Assessment:
Red List Category
LC
Least Concern
Red List Criteria
3.1
Year Assessed
2010
Assessor/s
Moelants, T.
Reviewer/s
Brummett, R., Mbe Tawe, A.N., Dening Touokong, C., Reid, G.M., Snoeks, J. Staissny, M., Moelants, T., Mamonekene, V., Ndodet, B., Ifuta, S.N.B., Chilala, A., Monsembula, R., Ibala Zamba, A., Opoye Itoua, O., Pouomogne, V., Darwall, W. & Smith, K.
Contributor/s
The species is widespread without major threats throughout central Africa and is assessed as Least Concern.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | © International Union for Conservation of Nature and Natural Resources |
| Source | http://www.iucnredlist.org/apps/redlist/details/181586 |
General Description:
Marcusenius moorii is recognized by the following combination of characters: eight circumpeduncular scales, 37–45 lateral line scales (median 41), 17–26 dorsal rays (median, 24), 24–33 anal fin rays (median, 30) and dark vertical bandcovered by two (rarely three) scales. Depth of body 26.6–32.8% SL; length of head 24.1–28.0% SL, head,1.1–1.3 times as long as deep. Snout blunt, its length, 24.5–28.6% HL; mouth terminal, submental swelling prominent and forward-projecting.Teeth, bicuspid, five in upper jaw, six in lower. Eye small, 12.9–15.6% of the length of the head. Dorsal fin length 18.5–20% SL, with 17–26 rays; anal fin length 23–26% SL, with 24–33 rays. Anal originates in advance of dorsal by 3 or 4 rays. Pre-anal distance 92.53–98.37% of predorsal distance. Pectoral fin, twice as long as pelvic, and extending slightly beyond its origin. Caudal peduncle length 15.8–18.9% SL, 2.3–3.1 times as long as high. Caudal fin small with pointed lobes. 37–45 scales in the lateral line, eight circumpeducular scales. Between the dorsal and anal fins there are 14–20 scale rows, including the lateral line. Color: reddish grey on flank in life, with dark grey-brown band between dorsal and anal fins, extending to the tips of the first 5–10 rays. Ground color in alcohol brown.
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | Sullivan, John P., Sullivan, John P., Hopkins, Carl D., Africhthy |
| Source | http://mormyrids.lifedesks.org/pages/2124 |
Population:
Population
No information available.
Population Trend
Unknown
| License | http://creativecommons.org/licenses/by-nc-sa/3.0/ |
| Rights holder/Author | © International Union for Conservation of Nature and Natural Resources |
| Source | http://www.iucnredlist.org/apps/redlist/details/181586 |